NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6012 Query DataSets for GPL6012
Status Public on Oct 31, 2007
Title A genome proxy array for profiling marine micobial communities
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms uncultured crenarchaeote 4B7; Prochlorococcus marinus subsp. pastoris str. CCMP1986; uncultured marine alpha proteobacterium; uncultured marine gamma proteobacterium EBAC31A08; uncultured marine group II euryarchaeote 37F11; uncultured proteobacterium; uncultured crenarchaeote 74A4; uncultured marine bacterium 440; uncultured marine bacterium 577; uncultured marine bacterium 583; uncultured gamma proteobacterium eBACHOT4E07; uncultured marine bacterium EB0_41B09; uncultured proteobacterium 60D04; uncultured proteobacterium 65D09; uncultured marine group II euryarchaeote EF100_57A08; uncultured marine bacterium EB000_55B11
Manufacturer DeLong Lab
Manufacture protocol ***Microarray construction*** Oligonucleotides were synthesized (Illumina, San Diego, California), suspended in 3XSSC to a concentration of 40pmol/μl, and spotted on homemade poly-L-lysine-coated glass slides using a QArray 2 microarraying robot (Genetix, Hampshire, England). Six replicates of each probe were spotted.
Support glass
Coating polylysine
 
Description ***Design Overview*** The prototype microarray targeted thirteen BAC or fosmid genome fragments (20-160kb) from both bacteria and archaea (Table 1), recovered from a variety of marine habitats (Table 2), as well as the cyanobacterium Prochlorococcus MED4. These clones were originally sequenced because of the presence of taxonomic marker or specific functional genes. This array consisted of sets of 70-bp oligonucleotides targeting each genome or genome fragment (Fig. 1), dispersed along the target sequences with no more than one probe per gene, and excluding rRNA genes as targets. The probes were selected solely based on theoretical thermodynamic properties and GC content (~40%); that is, probe selection did not focus on specific genes or regions, but simply produced the “optimal” probes for each genome proxy based on the probes’ predicted hybridization properties. rRNA genes were excluded, because this probe design approach, which avoids sequence alignments and considerations of RNA secondary structure, would be unlikely to result in useful rRNA probes. Furthermore, rRNA probes of traditional design could not be included on the array because their appropriate hybridization conditions would be very different from those of this array’s probes.
 
Contributor(s) Rich VI, DeLong EF
Submission date Oct 15, 2007
Last update date Oct 31, 2007
Contact name Virginia Isabel Rich
E-mail(s) vrich@email.arizona.edu
Organization name University of Arizona
Street address 1041 E. Lowell St.
City Tucson
State/province AZ
ZIP/Postal code 85721
Country USA
 
Samples (28) GSM237693, GSM237694, GSM237695, GSM237696, GSM237890, GSM237891 
Series (1)
GSE9384 Design and testing of genome-proxy microarrays to profile marine microbial communities

Data table header descriptions
ID
SEQUENCE Probe sequence
GENOME_ACC Genome Accession for the targeted genome or genome fragment to which the probe was designed
PT_ACC Protein Accession for the targeted ORF within each genome or genome fragment
SPOT_ID In-house ID
ORGANISM Targeted organism or environmental clone name
GENE_DESCRIPTION the Softberry-based annotation of the CDS to which the probe was designed; based on BLAST identity
GC % GC of the 70-mer probe, calculated by the program ArrayOligoSelector
delta_G the free energy of binding between the 70-mer probe and its perfect-match target, calculated by the program ArrayOligoSelector
int_score the internal repeat score of the 70-mer probe, calculated by the program ArrayOligoSelector
self_score the self annealing score of the 70-mer probe, calculated by the program ArrayOligoSelector

Data table
ID SEQUENCE GENOME_ACC PT_ACC SPOT_ID ORGANISM GENE_DESCRIPTION GC delta_G int_score self_score
ProMED4_01 GGGTCCTGGCCAACAAAATTCACAAGAGCCTGAAGAAAAGGATAAAGTTGAAGAAGATATTGATTCAGAG BX548174 NP_892137.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Heat shock protein GrpE 40 -98.399986 30 59
ProMED4_02 AAACAAATATTTCTGAGAAGAGACGCGAAAAAGCAAGGTGGGCTTTAGTTATTGGAGACGTTATGGGGAA BX548174 NP_892132.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Protein phosphatase 2C domain 40 -101.599983 31 60
ProMED4_03 CTTCTCATGATGTTAGTGATGGAGGTTTAGCTGTCGCTTTATCAGAATGTTGTATTCTGTCTTCTAAGGG BX548174 NP_892124.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 phosphoribosylformylglycinamidine synthetase II 40 -97.499992 30 61
ProMED4_04 CCTCTTCTTGAAAAAGCATGGGCAGAAGAAGCGGGTCTAGGTTGGATAGGCAAAAATAGTAATCTTATTA BX548174 NP_892128.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 conserved hypothetical protein 40 -99.199982 31 68
ProMED4_05 GACATTTAGAAGAGCCCTTTTGTAAGGGACACTTTGCAGATTTAACTTGTGATTCTGATGGCAAGCTGAA BX548174 NP_892166.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Orn/DAP/Arg decarboxylases family 2 40 -99.499992 30 70
ProMED4_06 CCTCGGGTTTTGGAAGAGAGTACAGGGAGAGATTAAATTATAAATGGGGTATTCTTGATTCATACGACTG BX548174 NP_892190.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Esterase/lipase/thioesterase family active site 40 -97.599998 28 71
ProMED4_07 CTCTTAAGGATGCTTCTACCTCCTCTAATAAACCAACAAGGTCATCTATCAGATCTCAGACTTCAACAGA BX548174 NP_892184.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 conserved hypothetical protein 40 -96.499992 31 72
ProMED4_08 GAAGGAATGCCGCCTTTGGTTACGTAATAGAGGGTTTTGATGTTTTAGAAGAGCTTACAAAAGATGACAC BX548174 NP_892146.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Cyclophilin-type peptidyl-prolyl cis-trans isomerase 40 -99.599991 30 76
ProMED4_09 AAGGCGCAAATTGTTTGCTAGAGGTTTTGGTTGAGGGAGCCAAGAGTAATTCAGATGCAATTAAAATAGC BX548174 NP_892171.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 ArgJ family 40 -100.79998 30 76
ProMED4_10 TTAGAGGAGTCTCCCAGTCCAGCTATAAACTATTCTCTTAGAAAAAAAATGGGTAATGCAGCCATTGCTG BX548174 NP_892181.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 acetyl-CoA carboxylase, biotin carboxylase subunit 40 -98.300003 30 76
ProMED4_11 GGGTACTGAAAGAGCATTTAGTAGTCAGCTAAACAATGAGAAGCGGAAAGGTATATTTTATTGTGCAGGC BX548174 NP_892136.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Domain of unknown function DUF25 40 -98.599991 29 77
ProMED4_12 GCCTTAGACATAGGATGGAAAGCCGTAGCATGTAATGTATCTGATTTAATCTCAAGTGGATGCAGCAAAA BX548174 NP_892145.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 putative thiamine-monophosphate kinase 40 -98.899994 29 78
ProMED4_13 GCATTAGTCAGTGCTGATGCTCAAGACATAGGGAATGCCAGCGAATTAGTTCCTGTATCTTTTTATTTTG BX548174 NP_892122.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 DNA polymerase III, beta chain 40 -98.899971 30 78
ProMED4_14 ATTATTACTAAATTAGATGGTACTTCAAGAGGTGGCGTTTCTCTGGCTGTTTCTGCAGAAGTCAATCTGC BX548174 NP_892131.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 signal recognition particle docking protein FtsY 40 -98.899971 30 79
ProMED4_15 ACCGTTGATGGTAAGGTTAATTTAAAGATTCCAAGTGGGACCCAGCCAAATAGCACTTTATCTCTTGAGA BX548174 NP_892138.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 DnaJ protein 40 -99.499985 30 79
ProMED4_16 TTAAGGATGATCAGCGGATTATGGGAACCCAATCAAGGATCGATTAAAAAACCAAAGACAGGTGATTTGC BX548174 NP_892186.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 ABC transporter, ATP binding protein 40 -100.099968 31 80
ProMED4_17 ATTTACGGGAAAAAGTTGCATATACTGCGGAAAACCTTCAGAATCCATTGACCATGTACTTCCTAGAAGC BX548174 NP_892152.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 HNH endonuclease:HNH nuclease 40 -99.799988 29 81
ProMED4_18 GAAGTAGAGCAGGTTAATAGGGTTGTTTTCGATATTACTAGTAAGCCTCCAGGAACAATTGAGTGGGAAT BX548174 NP_892158.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Glutamine amidotransferase class-I:GMP synthase 40 -97.899979 29 82
ProMED4_19 AAAGTGAGTTGTTAATAGTTGCTTTTGCACAAAATACGCCTGGTGGAGGATCTGTACATGCACTACCTAT BX548174 NP_892161.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Putative penicillin -binding protein 40 -99.800003 30 82
ProMED4_20 TATAGTCGTAAGCCATAGAAGACCTATGATAAGTGCATCTGAACGAACAATTGGTGTTGCTCAAGCAAGA BX548174 NP_892178.1 Prochlorococcus marinus subsp. pastoris str. CCMP1986 putative chromosome segregation protein, SMC ATPase superfamily 40 -99.699982 30 82

Total number of rows: 428

Table truncated, full table size 81 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap