|
| Status |
Public on Jun 28, 2021 |
| Title |
[ChIP-seq] B. anthracis 34F2 AtxA-1xFLAG #1 enriched |
| Sample type |
SRA |
| |
|
| Source name |
B. anthracis 34F2 AtxA-1xFLAG
|
| Organism |
Bacillus anthracis |
| Characteristics |
strain: BYF10078
genotype: B. anthracis 34F2 AtxA-1xFLAG
chip antibody: Anti-FLAG M2 affinity gel
|
| Growth protocol |
A colony of the strain grew on BHI plate at 37°C for overnight was inoculated into NBY medium supplemented with 8% NaHCO3, followed by shaking at 37°C under 15% CO2 for 3 h. 100-fold diluted in NBY medium supplemented with NaHCO3 and cultured at 37°C under 15% CO2 for 3 h.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
[ChIP-seq] Cells were pelleted and treated with 1% formaldehyde for for crosslinking. 250 mM glycine was added for quenching. After pelleting and resuspension in lysis buffer with cOmplete Mini Protease Inhibitor Cocktail, the samples were sonicated using Covaris S2. Supernatants were combined with Anti-FLAG M2 affinity gel for enrichment, followed by wash and protease K treatment at 65°C. [Cappable-seq] RNA was extracted using TRIzol after incubating the pellet with 2% SDS. After removing DNA with DNA-free DNA removal kit, RNA samples followed the protocol described before (Ettwiller et al, BMC Genomics 17:199, 2016) [3´-RACE] RNA was extracted using TRIzol after incubating the pellet with 2% SDS. DNA was removed with DNA-free DNA removal kit. [RNA-seq] RNA was extracted using TRIzol after incubating the pellet with 2% SDS. DNA was removed with DNA-free DNA removal kit. rRNA was depleted by the protocol described before (Culviner et al, mBio, 2020), followed by fragmentation with the treatment with a divalent cation and heat.
[ChIP-seq] Library was constructed with NEBNext Ultra II DNA Library Prep Kit for Illumina. [Cappable-seq, 3´-RACE, and RNA-seq] Library was constructed with NEBNext Multiplex Small RNA Library Prep Set for Illumina.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
[ChIP-seq] Sequence reads were applied for adapter trimming and quality filtering using Trim Galore! version 0.6.4_dev with the option "-a GATCGGAAGAGCACACGT", followed by mapping to the genome sequence of B. anthracis Ames ancestor strain (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using BWA-mem 0.7.17. The mapping data was applied for R package csaw 1.22.1 with 158 bp of fragment length and 50 bp of window width.
[Cappable-seq] For the analysis of sequence reads, adapter sequence was removed using cutadapt 2.1 with the option "-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", followed by mapping to the genome sequence of B. anthracis Ames ancestor (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using Bowtie2 2.3.5 with the option "-L 16". Coverage of the first base of mapped reads was calculated for each position with considering strands.
[3´-RACE] Reads were mapped to B. anthracis Ames ancestor (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using BWA-backtrack 0.7.17.
[RNA-seq] Reads were trimmed using Trim Galore! 0.6.4_dev with the option "-a AGATCGGAAGAGA", mapped to B. anthracis Ames ancestor (RefSeq assembly accession no. GCF_000008445.1 with manual modification for sequence difference in xrrC) using BWA-mem 0.7.17, and tag counted with htseq-count.
|
| |
|
| Submission date |
Feb 27, 2021 |
| Last update date |
Jun 29, 2021 |
| Contact name |
Yoshikazu Furuta |
| E-mail(s) |
yfuruta@czc.hokudai.ac.jp
|
| Organization name |
Hokkaido University
|
| Department |
International Institute for Zoonosis Control
|
| Lab |
Division of Infection and Immunity
|
| Street address |
North 20 West 10, Kita-ku
|
| City |
Sapporo |
| State/province |
Hokkaido |
| ZIP/Postal code |
001-0020 |
| Country |
Japan |
| |
|
| Platform ID |
GPL29781 |
| Series (1) |
| GSE167871 |
Direct regulons of the master virulence regulator AtxA of Bacillus anthracis |
|
| Relations |
| BioSample |
SAMN18084045 |
| SRA |
SRX10185359 |
