 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 25, 2022 |
| Title |
LR_GG_CoIP_WT_native_leader_array_R1 |
| Sample type |
SRA |
| |
|
| Source name |
L. rhamnosus GG cells
|
| Organism |
Lacticaseibacillus rhamnosus |
| Characteristics |
strain: GG
crispr array leader: native leader
antibody for coip: ANTI-FLAG M2 (Sigma, cat. #F 1804)
replicate: R1
|
| Treatment protocol |
No treatment applied during growth. Bacterial lysates from biological replicates were used for coIP.
|
| Growth protocol |
E. coli cells were grown at 37°C in Luria Bertani (LB) broth (5 g/L NaCl, 5 g/L yeast extract, 10 g/L tryptone) with shaking at 250 rpm. The antibiotic kanamycin was added at 50 µg/mL to maintain plasmids. L. rhamnosus cells were grown at 37°C in De Man, Rogosa and Sharpe (MRS) broth (Becton Dickinson) without agitation. The antibiotic chloramphenicol was added at 10 µg/mL to maintain plasmids.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Briefly, the cells harboring corresponding plasmids were lysed, tagged proteins were enriched through immunoprecipitation, and RNA bound to the tagged proteins were extracted using phenol-chloroform-isoamyl alcohol method for RIP-seq. The cells harboring the plasmids encoding untagged proteins were subjected to the same extraction procedures to use as controls.
The extracted RNA was treated with DNase I (Thermo Scientific, EN0525) following the manufacturer’s instructions. cDNA libraries for Illumina sequencing were constructed by Vertis Biotechnologie AG, Germany (http://www.vertis-biotech.com). Briefly, the resulting RNA was subjected to oligonucleotide adapter ligation on the 3′ end, first-strand cDNA synthesis using M-MLV reverse transcriptase (Agilent), and Illumina TruSeq sequencing adapter ligation on the 3′ end. The resulting cDNA was PCR-amplified using Herculase II Fusion DNA Polymerase (Agilent) with 13 amplification cycles following the manufacturer’s instructions, purified using Agencourt AMPure XP kit (Beckman Coulter Genomics) following the manufacturer’s instructions, and analyzed by capillary Electrophoresis.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
RNA bound non-specifically
eluted after co-immunoprecipitation with anti-FLAG antibody
|
| Data processing |
Base calling with Illumina NextSeq RTA v2.11.3
FASTQ conversion with bcl2fastq v2.20.0.422
FASTQ quality and adapter trimming using Cutadapt (Martin, 2011) version 2.5 (cutadapt parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)
Alignment of reads longer than 11 nt to reference genome using segemehl version 0.2.0 with minimum accuracy 95% (parameters for reademption align: -l 12 -a 95 ) (READemption 0.4.5, Förstner et al., 2014)
Coverage calculation via reademption coverage based on all aligned reads (full-length); Normalization: coverage-tnoar_mil_normalized (counts divided by total number of aligned reads and multiplied by 1,000,000) (READemption 0.4.5, Förstner et al., 2014)
Genome_build: E. coli K-12 BW25113: RefSeq assembly GCF_000750555.1 together with NL-Tagged-SpCas9-Plasmid (native leader, https://benchling.com/s/seq-JlrK1TcQnY4F3exlry0o) or ML-Tagged-SpCas9-Plasmid (mutated leader, https://benchling.com/s/seq-YJpL5iHCvtffFQaxEwFE); L. rhamnosus GG: RefSeq assembly GCF_000026505.1 and Tagged-LrCas9-Plasmid (https://benchling.com/s/seq-n65S4AdjwUw640uzpcNU)
Supplementary_files_format_and_content: wiggle files containing positional read coverage values
|
| |
|
| Submission date |
May 19, 2021 |
| Last update date |
Jan 25, 2022 |
| Contact name |
Tom Gräfenhan |
| E-mail(s) |
ht-seq.sysmed@uni-wuerzburg.de
|
| Phone |
+49 - 931 - 31 - 80814
|
| Organization name |
University of Wuerzburg
|
| Department |
Core Unit SysMed
|
| Lab |
Raum D15.02.045
|
| Street address |
Josef-Schneider-Str. 2, Bau D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL30159 |
| Series (1) |
| GSE158637 |
Spacer prioritization in CRISPR-Cas9 immunity is enabled by the leader RNA |
|
| Relations |
| BioSample |
SAMN19267441 |
| SRA |
SRX10932593 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5322358_LR_GG_CoIP_WT_native_leader_array_R1_forward.wig.gz |
4.1 Mb |
(ftp)(http) |
WIG |
| GSM5322358_LR_GG_CoIP_WT_native_leader_array_R1_reverse.wig.gz |
4.6 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
