NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15014 Query DataSets for GPL15014
Status Public on Jun 10, 2012
Title Chr. Hansen A/S_Streptococcus thermophilus_2304_v2.0
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Streptococcus thermophilus
Manufacturer Chr. Hansen A/S
Manufacture protocol DNA oligos were purchased from Bioneer Corporation at 50nmol synthesis scale with BioRP purification and in lyophilized state (Daedeok-gu, Daejeon, South Korea). Oligos were dissolved at 10uM in 50% DMSO and printed in 2 replicates on UltraGAPS slides (Corning B.V., Schiphol-Rijk, The Netherlands) using a Genpak ARRAY 21 arrayer (Genetix Ltd., Hampshire, United Kingdom) with 16 SMP3 pins, (TeleChem International Inc., Sunnyvale, CA) giving a spot diameter of 100-120mm. Washing was performed between each print cycle for 20s in water followed by 20s in 70% ethanol. The relative humidity was kept at 48 ± 5% by placing a water bath at the appropriate temperature below the air inlet of the arrayer. The oligos were cross-linked to the surface using a Stratalinker 1800 UV Crosslinker set at 70mJ/cm2 (Stratagene). Printed arrays were stored in aluminium pouches with five arrays each and silica gel to remove humidity.
Support glass
Coating aminosilane
 
Description Array layout file, i.e. the *.gal file, is attached.
 
Contributor(s) Valina O, Rasmussen TB, Pedersen MB
Submission date Dec 15, 2011
Last update date Jun 10, 2012
Contact name Martin Bastian Pedersen
E-mail(s) martinbastianpedersen@gmail.com
Organization name Sacco Srl
Department R&D
Street address Via Manzoni 29
City Cadorago
State/province CO
ZIP/Postal code IT-22071
Country Italy
 
Samples (1) GSM849537
Series (2)
GSE34461 Comparing two transcriptome technologies - sequencing match microarrays [Array]
GSE34478 Comparing two transcriptome technologies - sequencing match microarrays

Data table header descriptions
ID
PT_GI Protein GI number
SEQUENCE Oligo (probe) sequence
PROT_FUNC Protein function (annotation)

Data table
ID PT_GI SEQUENCE PROT_FUNC
stl0001 55820104 tttattcaaggagatgaaaaccgctggtctgtagcagcatctctagctgtagctgattcaccagg chromosomal replication initiator protein DnaA
stl0002 55820105 gctgaaacgtcatttgcagcaagcacgcaagaaagtcgtccaattttaactggagttcactttgt beta subunit of DNA polymerase III
stl0003 55820106 atcaaagcaacaggaaaaaaagctaacgagtgggaagtgactcgtcttggagctgacataaaaattc hypothetical protein
stl0004 55820107 agacagtgccaactacatttgagttcacagatattgcgggtatcgtaaaaggggcatcaaagggt GTP-binding protein
stl0005 55820108 tatcgtcatttacgatgatttagatatggaagttgggaaattgcgctttcgtcaaaagggatcagc peptidyl-tRNA hydrolase
stl0006 55820109 ccggcggatgatattatcttaacaagagaagattaccaacgtgctgagaaggccctagaaagtgc transcription repair coupling factor
stl0007 55820110 ttggaaataaacttttgactgttcgtgttctagaaatgaaagacagtacgaaaaaagaagatgcagcaaaaatgt conserved hypothetical protein, S4 domain protein
stl0008 55820111 acagcaagagaaggaagtcttgtcattacagaaagactatgataaattgtcagatcagacaaaggaacgaaagga cell-cycle protein, MesJ/Ycf62 family, putative
stl0009 55820112 aaaagctgactctaaactcgctagtttcaaaccgataaaggttagccgagctgcccagacgcatg hypothetical protein
stl0010 55820113 ctgctcttgttacagcccatcatgctgatgatcaggctgagacaatttttatgagattgttgagag putative cell-cycle protein, MesJ/Ycf62 family
stl0011 55820114 tattgatacacatattgagatggactttatggttgtttcaagctatggtggcgggactgtcagca hypoxantine-guanine phosphorybosyltransferase
stl0012 55820115 tccacgtaaatataaagctttgggtgcacgtattcctaaaggagtcctcctcgaaggccctccag cell division protein
stl0013 55820116 acaagattatgaatgtactggaacttccccactcaaacgcaaaactagaggataccactaacctcatcaaagaca IS1167, transposase, ISL3 family, truncated
stl0015 55820118 aacacataaagaaatcatcgctaagctagattaccctgctcctaagtgtctcgactgtcaaggacaaatggc IS1167, transposase, ISL3 family, truncated
stl0016 55820119 atatatgaattgagaaagcaaggtcaaaccttcaacaaactttcaaaacgatttggtgtggatgcttctggatta IS861, transposase (orf1), IS3 family, truncated
stl0018 55820121 aaactgcacgtttatctcgctcgacttactattatcagttgaaacaactagatgggcacgacaaagatgaagaga IS861, transposase (orf2), IS3 family, truncated
stl_r01 gccttgtagcgggggataactattggaaacgatagctaataccgcataacaatggatgacacatg 16S rRNA
stl_r02 ccggcaggtaatgcctgtcactcattactgttaaggtaatgtagaggaagacgcagtgaactgaa 23S rRNA
stl0020 55820123 ccagggatgtttcttctaatgtctcggtagttgtgtctaaagtagattctgttatttcagttccatttactgca rod shape-determining protein MreC
stl0021 55820124 cgtcccacctctttattatctatctattcatcttaactctcagccgtccttataattgttcacttctataccttg rod shape-determining protein MreD

Total number of rows: 2304

Table truncated, full table size 264 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL15014_20110928_ST_GEO.gal.gz 30.9 Kb (ftp)(http) GAL

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap