NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL5158 Query DataSets for GPL5158
Status Public on May 23, 2007
Title Technical Microbiology-Viable beer spoilage bacteria microarray V2
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Pectinatus frisingensis; Levilactobacillus brevis; Lacticaseibacillus casei; Loigolactobacillus coryniformis; Megasphaera cerevisiae; Pediococcus damnosus; Pectinatus cerevisiiphilus; Schleiferilactobacillus perolens; Pediococcus inopinatus
Manufacturer Institut für Biotechnologie 1
Manufacture protocol Standard glass microscope slides were coated with a poly-L-lysine solution and stored for several weeks to allow the surface to become sufficiently hydrophobic. Species-specific probes were spotted in 3x SSC onto the glass surface using a robotic printing system. For routine experiments 50 μM was used as probe concentrations. The diameter of the spots was 150 μm and the space between the centres of two spots was 205 μm allowing the preparation of seven grids each containing 70 spot replicates. To distribute the oligonucleotides more evenly, the spots were rehydrated using a 1x SSC bath at 40°C until the spots were glistening, followed by snapped-drying at 120°C using a heat block. To increase the amount of hybridisable oligonucleotides, stably attached to each spot, the nucleic acids were cross-linked by UV irradiation.
Support glass
Coating polysine
 
Description Each oligonucleotide species-specific probe was spotted in 70 replicate spots on the microarray. Nine single beer spoilage bacteria species were detected with the developed prototype oligonucleotide microarray and also three mixes of two different beer spoilage bacteria species.
 
Contributor(s) Weber DG, Sahm K, Polen T, Wendisch VF, Antranikian G
Submission date May 11, 2007
Last update date May 23, 2007
Contact name Daniel Gilbert Weber
Organization name IPA
Department Molekulare Medizin
Street address Bürkle-de-la-Camp Platz 1
City Bochum
ZIP/Postal code 44789
Country Germany
 
Samples (4) GSM190246, GSM190247, GSM190248, GSM190249
Series (1)
GSE7840 Oligonucleotide microarrays for the detection and identification of viable beer spoilage bacteria

Data table header descriptions
ID
SEQUENCE Sequence of the species-specific oligonucleotide probe
Organisms Target species
SPOT_ID

Data table
ID SEQUENCE Organisms SPOT_ID
1 TTGACGATCACGAAGTGAC Lactobacillus brevis species-specific oligo probe for Lactobacillus brevis
2 TGAGGGGATCACCCTCAA Lactobacillus casei species-specific oligo probe for Lactobacillus casei
3 CCGAGAATTAACACTGCGTT Lactobacillus coryniformis species-specific oligo probe for Lactobacillus coryniformis
6 AAGTCCGCCGAATCAAGC Lactobacillus perolens species-specific oligo probe for Lactobacillus perolens
7 AACCGAGAACATTGCGTTTT Pediococcus damnosus+Pediococcus inopinatus species-specific oligo probe for Pediococcus damnosus+Pediococcus inopinatus
8 TCCGGCGAAGTAGAGATACAG Megasphaera cerevisiae species-specific oligo probe for Megasphaera cerevisiae
9 ATGGCGGGGAATAGTTGG Pectinatus cerevisiiphilus+Pectinatus frisingensis species-specific oligo probe for Pectinatus cerevisiiphilus+Pectinatus frisingensis

Total number of rows: 7


Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap