 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 12, 2016 |
| Title |
ScaleUpDesign2_SV40P_Plasmid |
| Sample type |
SRA |
| |
|
| Source name |
Plasmid pool
|
| Organism |
Escherichia coli |
| Characteristics |
source: plasmid
promoter: SV40
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Total RNA was isolated from cell lysates using RNeasy kits (Qiagen). mRNA was extracted from total RNA using MicroPoly(A)Purist™ kits (Ambion) and treated with DNase I using the Turbo DNA-free™ kit (Ambion).
First-strand cDNA was synthesized from 400-700 ng mRNA using High Capacity RNA-to-cDNA kits (Applied Biosystems). Tag-Seq sequencing libraries were generated directly from 12% of a cDNA reaction or 50 ng plasmid DNA by 26 cycle PCR using Pfu Ultra HS DNA polymerase 2x master mix (Agilent) and primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTGCCTAAAGG (where XXXXXXXX is a library-specific index sequence). The resultant PCR products were size-selected using 2% agarose E-Gel EX (Invitrogen).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Scale-up Design 2 (5-bp steps), MPRA plasmid pool, replicate 1 and 2
|
| Data processing |
To infer the tag copy numbers in each Tag-Seq library, all sequence reads were examined, regardless of their quality scores. If the first ten nucleotides of a read perfectly matched one of the 54K (pilot) or ~ 244K (scale-up) designed tags and the remaining nucleotides matched the expected upstream MPRA construct sequence, this was counted as one occurrence of that tag. All reads that did not meet this criterion were discarded.
Genome_build: hg19 for coordinates in *ScaleUpDesign*.counts.txt file
Supplementary_files_format_and_content: The first tab delimited column contains the construct ID, the second column the DNA sequence to which it corresponds, the third column all the barcode tag IDs in comma delimited form if more than one, the fourth column the corresponding counts for the tags also in comma delimited form if more than one. In the ScaleUpDesign construct IDs are of form CELLTYPE_STATE_REGIONINSTATE_TILEPOS_chr_center where CELLTYPE and STATE are the cell type and chromatin state based on which the regulatory region was selected, REGIONINSTATE is an ID among selections from the CELLTYPE and STATE combination, TILEPOS is the tile position and ranges from 0 to 30 where TILEPOS=0 is the first tile, and chr and center and the chromosome and coordinate of the center base (hg19) of the regulatory region being tiled. In the PilotDesign construct IDs are of the form GROUP_REGIONIDINGROUP_TILEPOS. GROUP is from the set {high,range,controlhigh} where high corresponds to regions selected based on being in candidate enhancer chromatin states in HepG2 with the strongest H3K27ac dip scores, range represents enhancers with a range of dip scores, and controlhigh are locations in candidate enhancers in K562 but not HepG2. REGIONIDINGROUP is an ID among selections in the GROUP. TILEPOS is the tile position and ranges from 0 to 8 where TILEPOS=0 is the first tile.
|
| |
|
| Submission date |
Jul 23, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Jason Ernst |
| E-mail(s) |
jason.ernst@ucla.edu
|
| Organization name |
UCLA
|
| Department |
Biological Chemistry
|
| Street address |
615 Charles E Young Dr South
|
| City |
Los Angeles |
| State/province |
CA |
| ZIP/Postal code |
90095 |
| Country |
USA |
| |
|
| Platform ID |
GPL18133 |
| Series (1) |
| GSE71279 |
Genome-scale high-resolution mapping of activating and repressive nucleotides in regulatory regions |
|
| Relations |
| BioSample |
SAMN03897404 |
| SRA |
SRX1116943 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1831776_ScaleUpDesign2_SV40P_Plasmid.counts.txt.gz |
4.1 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
