|
Status |
Public on Jun 06, 2020 |
Title |
10 LIN WT Cassette 5 2 (G57) |
Sample type |
SRA |
|
|
Source name |
Escherichia coli genome
|
Organism |
Escherichia coli |
Characteristics |
grna seqeunce: GGCTAACTACGTTCGTGGCG galk location: 0.82 MB from ter cas9 promoter: araC repair donor type: Linear
|
Treatment protocol |
Cells for genome sequencing were scraped from LB agar plates with 1X PBS after overnight growth of the recovery mixture. Care was taken to collect at least 250-500 colonies for adequate representation of the population.
|
Growth protocol |
The cells were grown at 30 deegrees C on LB+Agar plates overnight.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Fifty µL of the scraped cell suspension was subjected to centrifugation in a 1.5 mL tube. The cells were washed twice with PBS and as much of the supernatant was removed as possible. Finally, the cells were suspended in 50 µL TE buffer (pH 8.0). The resuspended cells were boiled at 100 OC for 10 minutes. The genomic region to be sequenced was amplified using primers with Illumina Nextera adapters
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina MiSeq |
|
|
Data processing |
Library strategy: DNA-seq Reads were assembled using PandaSeq tool The merged reads were aligned to a database of known sequences using usearch to map reads to a sequence Genome_build: N/A Supplementary_files_format_and_content: tab delimited text table containing query from nextseq, target, %identity, aln_len, number mismatches, number indels, qrow, trow and alignment qrowdots
|
|
|
Submission date |
Jun 03, 2019 |
Last update date |
Jun 07, 2020 |
Contact name |
Alaksh Choudhury |
E-mail(s) |
alaksh.choudhury@colorado.edu
|
Phone |
0676358338
|
Organization name |
INSERM
|
Department |
IAME
|
Lab |
QEM
|
Street address |
16 Rue Henri Huchard
|
City |
Paris |
ZIP/Postal code |
75019 |
Country |
France |
|
|
Platform ID |
GPL16085 |
Series (1) |
GSE132139 |
Determinants for efficient editing with Cas9-mediated recombineering in Escherichia coli |
|
Relations |
BioSample |
SAMN11948313 |
SRA |
SRX5962026 |