NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3847332 Query DataSets for GSM3847332
Status Public on Jun 06, 2020
Title 10 LIN WT Cassette 5 2 (G57)
Sample type SRA
 
Source name Escherichia coli genome
Organism Escherichia coli
Characteristics grna seqeunce: GGCTAACTACGTTCGTGGCG
galk location: 0.82 MB from ter
cas9 promoter: araC
repair donor type: Linear
Treatment protocol Cells for genome sequencing were scraped from LB agar plates with 1X PBS after overnight growth of the recovery mixture. Care was taken to collect at least 250-500 colonies for adequate representation of the population.
Growth protocol The cells were grown at 30 deegrees C on LB+Agar plates overnight.
Extracted molecule genomic DNA
Extraction protocol Fifty µL of the scraped cell suspension was subjected to centrifugation in a 1.5 mL tube. The cells were washed twice with PBS and as much of the supernatant was removed as possible. Finally, the cells were suspended in 50 µL TE buffer (pH 8.0). The resuspended cells were boiled at 100 OC for 10 minutes.
The genomic region to be sequenced was amplified using primers with Illumina Nextera adapters
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model Illumina MiSeq
 
Data processing Library strategy: DNA-seq
Reads were assembled using PandaSeq tool
The merged reads were aligned to a database of known sequences using usearch to map reads to a sequence
Genome_build: N/A
Supplementary_files_format_and_content: tab delimited text table containing query from nextseq, target, %identity, aln_len, number mismatches, number indels, qrow, trow and alignment qrowdots
 
Submission date Jun 03, 2019
Last update date Jun 07, 2020
Contact name Alaksh Choudhury
E-mail(s) alaksh.choudhury@colorado.edu
Phone 0676358338
Organization name INSERM
Department IAME
Lab QEM
Street address 16 Rue Henri Huchard
City Paris
ZIP/Postal code 75019
Country France
 
Platform ID GPL16085
Series (1)
GSE132139 Determinants for efficient editing with Cas9-mediated recombineering in Escherichia coli
Relations
BioSample SAMN11948313
SRA SRX5962026

Supplementary file Size Download File type/resource
GSM3847332_62.fastq.assembled.fastq.txt.gz 451.7 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap